|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CLINICAL STUDIES |
iková3,4,51 Inserm, U858 Équipe 3, Institut de Médecine Moléculaire de Rangueil, BP84225, Toulouse F-31432 Cedex 4, France2 Université de Toulouse,, Institut Louis Bugnard IFR31, Toulouse F-31432, France3 Franco-Czech Laboratory for Clinical Research on Obesity,, 4 Department of Sports Medicíne and 5 Division of Cell and Molecular Biology,, 3rd Faculty of Medicine, Charles University in Prague, Prague CZ-100 00, Czech Republic
(Correspondence should be addressed to I Castan-Laurell; Email: isabelle.castan{at}toulouse.inserm.fr)
| Abstract |
|---|
|
|
|---|
(TNF-
) in adipose tissue (AT). Plasma apelin levels are increased in obese hyperinsulinemic subjects. The aim was to investigate whether the hypocaloric diet associated with weight loss modifies the elevated plasma apelin levels and the expression of apelin and APJ receptor in AT in obese women.
Design and methods: Fasting plasma levels of apelin and TNF-
as well as mRNA levels of apelin and APJ in AT were measured before and after a 12-week hypocaloric weight-reducing diet in 20 obese women (body mass index (BMI) before diet 32.2±6.4 kg/m2). Twelve healthy women with a BMI of 20.7±0.6 kg/m2 served as reference.
Results: Plasma levels of apelin and TNF-
were higher in obese compared with lean controls. The hypocaloric diet resulted in a significant decrease of BMI to 29.8±6.3 kg/m2, plasma insulin (8.16±0.73 to 6.58±0.66 mU/l), apelin (369±25 pg/ml to 257±12 pg/ml), TNF-
levels (0.66±0.04 pg/ml to 0.56±0.04 pg/ml), and AT mRNAs of apelin and APJ. In addition, changes in AT mRNA apelin were related to changes in AT mRNA APJ levels.
Conclusion: The hypocaloric diet associated with weight loss reduces the increased plasma and AT expression of apelin in obese women. This reduced apelin expression in AT could contribute to decreased circulating apelin levels.
| Introduction |
|---|
|
|
|---|
So far, few data regarding the regulation of apelin or APJ are available, especially in humans. Apelin and APJ expression have been shown to follow the same pattern of regulation in human heart failure (9). Regulation of apelin expression by insulin (1) and tumor necrosis factor (TNF-
) (10) in human adipocytes or adipose tissue (AT) has also been reported. Moreover, the basal plasma levels of apelin are significantly higher in obese patients compared with control lean individuals (1), correlating positively with body mass index (BMI) (11). These data suggest that apelin could play an important role in obesity-related metabolic and cardiovascular alterations.
Therefore, the aim of this study was to investigate whether the increased plasma apelin levels previously reported in obese subjects are reduced after a hypocaloric diet in obese women and to study the effect of the hypocaloric diet on the expression of apelin and APJ in human s.c. abdominal AT.
| Subjects and methods |
|---|
|
|
|---|
Twenty obese women (age 39.4±9.5 years, range of body weight 72.5–132.5 kg) with a BMI of 32.2±1.4 kg/m2 participated in the study. All women were premenopausal, drug free, and, based on their medical history, clinical findings and entry laboratory examination, did not suffer of any disease besides obesity. Their body weight was stable for at least 3 months before the beginning of the study. To obtain references values, 12 healthy and lean women (age 37.7±2.8 years, weight 57.1±1.3 kg, BMI 20.7±0.6 kg/m2, fat mass 22.5±1.9%) were chosen. Informed consent to participate in the study was obtained from each subject before the beginning of the experiments. The study was performed according to the Declaration of Helsinki and approved by the Ethical Committee of Third Faculty of Medicine (Prague, Czech Republic).
Examination procedures
The subjects were investigated at 0800 h after an overnight fast before and at the end of 12 weeks of low-calorie diet (LCD). The clinical parameters of the subjects are shown in Table 1. Body composition was assessed using multifrequency bioimpedance (Bodystat, Quad scan 4000, Isle of Man, UK). Coefficients of variation of fat mass, fat-free mass, and impedance were 1.7, 0.8, and 1.5% respectively. Samples of 10 ml blood were collected on 50 µl of an anticoagulant and antioxidant cocktail (Immunotech, Marseille, France) and processed immediately in a refrigerated centrifuge. The plasma was stored at –80 °C until analysis. Needle biopsy of s.c. AT (0.5–1.0 g) was performed under local anesthesia (1% Xylocain) in the abdominal region (10–15 cm lateral of umbilic) and immediately frozen.
|
The diet was designed to provide 600 kcal/day less than the individually estimated energy requirement, based on calculated pretreatment resting metabolic rate multiplied by a coefficient of correction for physical activity level of 1.3. The target macronutrient composition of the diet was 25–30% of total energy from fat, 15% from protein, and 55–60% from carbohydrate. The subjects were given oral and written instructions relating to these targets based on either a template or an exchange system. The subjects were requested to abstain from alcohol consumption. The dietary instructions were reinforced and monitored by dieticians weekly. Compliance to the diet was monitored using 1-day weighed food records that were presented each week during the above-mentioned dietary consultation session. In addition to that, a 3-day weighed food record of two weekdays and one weekend day was performed before the study and during the last week of the intervention. The dietary records were analyzed using the food nutrient database routinely used in each center.
Real-time RT-PCR
Total RNAs (0.5 µg) were isolated from AT biopsies using RNeasy Lipid Tissue Kits (Qiagen) and were reverse transcribed using random hexamers and Superscript II reverse transcriptase (Invitrogen). Real time PCR was generated by SYBER green method and performed as previously described (1). Analysis of the 18S rRNA was performed in parallel using the rRNA control Taqman Assay Kit (Applied Biosystem, Foster City, CA, USA) to normalize gene expression. The following oligonucleotide primer pairs were used: apelin Sens: GCGGTTATGTCTCCTCCATAGATT, Reverse: GTGCGAGGTGAGAGCTGAATG; APJ Sens: GCCCTTGCTTTCTGAAAATCA, Reverse: GGACAGTTAAAGGATGTGCATAGGA.
Analytical methods
Plasma glucose was determined by the glucose-oxidase technique (Beckman Instruments, Brea, CA, USA). Plasma insulin concentration was measured by RIA (Immunotech, Czech Republic). Plasma apelin levels were measured with a commercially available enzyme-linked immunoassay (ELISA) kit (Phoenix Pharmaceuticals, Burlingame, CA, USA). The sensitivity of the assay was 0.2 ng/ml and the intra-assay error was below 5%. The ELISA had 100% cross-reactivity with human apelin-12, apelin-13, and apelin-36. Concentrations of TNF-
in plasma were measured using ultra-sensitive ELISA kit (Biosource International, Camarillo, CA, USA).
Statistical analysis
Statistical analysis was performed using SPSS 12.0 for Windows (SPSS Inc., Chicago, Illinois, USA). Differences were tested with non-parametric Wilcoxon's test for paired observations. Correlations were analyzed by Spearman's non-parametric test. Data are presented as means±S.E.M. Differences at the level of P<0.05 were considered statistically significant.
| Results |
|---|
|
|
|---|
The LCD resulted in mean body weight loss of 6.7±0.6 kg (7.4% loss of the initial body weight), a reduction of total and high density lipoprotein (HDL) cholesterol, plasma triglycerides, and no change in blood glucose and blood pressure. Moreover, homeostasis model assessment index of insulin resistance (HOMA-IR) was decreased suggesting an increase in insulin sensitivity of the subjects (Table 1).
Effect of LCD on plasma apelin, insulin, and TNF-
levels
Apelin plasma levels were elevated in obese (369±25 pg/ml, n=20) compared with lean women (272±20 pg/ml, n=12, P=0.02). After LCD, plasma levels of apelin in obese subjects were significantly decreased (Fig. 1). Plasma concentrations of TNF-
(0.66±0.04 pg/ml, n=20 vs 0.54±0.07 pg/ml, n=12, P=0.014) and insulin (8.16±0.73 mU/ml, n=20 vs 4.31±0.56 mU/ml, n=12) were also higher in obese compared with controls and, like apelin, decreased after LCD (Fig. 1).
|
No correlation between the diet-induced decrease of insulin or TNF-
blood levels and plasma apelin was found in the entire group. Then the patients were stratified into two subgroups according to the magnitude of the diet-induced decrease of insulin resistance: group 1 (designated as high responders, n=12) with a decrease of HOMA-IR by more than 20% of the initial value and group 2 (low responders, n=8) with a decrease of HOMA-IR
20%. In the subgroup of high responders, the diet-induced changes in plasma apelin levels directly correlated with the diet-induced decrease of metabolic variables such as plasma insulin and TNF-
levels (Table 2) but also the decrease of HOMA-IR, waist circumference, and waist-to-hip ratio.
|
In order to know whether the observed decrease of apelin plasma levels could be due to reduced production of apelin by AT, apelin mRNA level was measured in lean and obese subjects before and after LCD. Apelin mRNAs were increased in obese compared with lean subjects (Fig. 2A) and a significant diet-induced decrease of apelin mRNA was observed after LCD. Thus, apelin plasma levels and apelin expression in AT were decreased in obese subjects after LCD (Fig. 3). Since apelin and APJ expression have been shown to often follow the same regulation pattern (9), we studied the expression of APJ in AT in lean and obese subjects before and after LCD. Interestingly, the expression of apelin receptor APJ was also significantly increased in obese compared with lean subjects and decreased in AT after LCD (Fig. 2B). Moreover, a tight positive correlation was observed between changes in apelin and changes in APJ mRNA levels (Fig. 4).
|
|
|
| Discussion |
|---|
|
|
|---|
It is interesting to note that the relationship between apelin and insulin or TNF-
during obesity and obesity-associated disorders (1, 10, 12) is still maintained at the end of the hypocaloric diet but is dependent of the magnitude of insulin sensitivity. Therefore, insulin and TNF-
could be potential candidates involved in the regulation of the diet-induced decrease of apelin blood levels, in agreement with previous studies (1, 6, 10). Leptin could be another candidate regulating apelin production. Indeed, a high correlation has been described between apelin gene expression in s.c. AT and leptin serum or leptin mRNA in rat AT (13). In addition, since a correlation between apelin and HOMA-IR was observed only in subjects ameliorating their insulin sensitivity, the relationship between apelin and insulin resistance is strengthened. The relationship of apelin to blood pressure changes was not assessed since in spite of diet-induced apelin decrease, no correlation between the individual diet-induced change of plasma apelin and systolic and diastolic blood pressure were found. Thus, both plasma apelin and apelin AT mRNA were decreased after LCD suggesting that the reduced apelin expression in AT could contribute to decreased circulating apelin levels. In the present study, AT was obtained from the abdominal s.c. region. The comparative value of apelin expression between intra-abdominal and s.c. AT, and hence their relative contribution to plasma apelin levels are not known. Cross-sectional studies investigating the expression of apelin in visceral fat in relation to s.c. fat expression and to metabolic indices are certainly warranted. However, during dietary intervention, changes in sites other than AT of apelin production are not excluded.
In addition to the effect of the hypocaloric diet on apelin, we also studied APJ expression in AT. Apelin and APJ receptor are often co-localized in the same tissues and display similar variations of expression. The most documented co-regulation of the apelin/APJ system was reported in the cardiovascular domain. Either down-regulated (9) or increased expression (14) of both apelin and APJ were observed in humans or rodents heart presenting cardiac dysfunction. In the present study, we found not only a decrease of APJ and apelin expression after LCD period but also a significant correlation between the diet-induced changes of apelin and APJ expression in AT. Therefore, a similar regulation of apelin and APJ mRNA expression in human AT may be suggested and a common factor regulating apelin and APJ expression could be hypothesized.
In conclusion, the present study demonstrates that, in obese women, the hypocaloric diet associated with weight reduction and with a decrease of insulin resistance promotes a reduction of the elevated plasma apelin levels and the expression of apelin and APJ in s.c. AT. Although apelin has been viewed as a beneficial adipokine up-regulated in obesity (15, 16), it remains to establish whether the increased levels of apelin observed in obesity are an attempt to overcome either insulin resistance or obesity-related cardiovascular diseases or another metabolic defect such as apelin resistance. Thus, understanding the contribution of such an adipokine in obesity-associated disorders appears to be of major importance.
| Acknowledgements |
|---|
| Footnotes |
|---|
|
|
|---|
| References |
|---|
|
|
|---|
up-regulates apelin expression in human and mouse adipose tissue. FASEB Journal 2006; 20: 1528–1530.This article has been cited by other articles:
![]() |
P. Yue, H. Jin, M. Aillaud, A. C. Deng, J. Azuma, T. Asagami, R. K. Kundu, G. M. Reaven, T. Quertermous, and P. S. Tsao Apelin is necessary for the maintenance of insulin sensitivity Am J Physiol Endocrinol Metab, January 1, 2010; 298(1): E59 - E67. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-E. Lee, S. Kehlenbrink, H. Lee, M. Hawkins, and J. S. Yudkin Getting the message across: mechanisms of physiological cross talk by adipose tissue Am J Physiol Endocrinol Metab, June 1, 2009; 296(6): E1210 - E1229. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |