Eur J Endocrinol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

DOI: 10.1530/EJE-08-0039
European Journal of Endocrinology, Vol 158, Issue 6, 905-910
Copyright © 2008 by European Society of Endocrinology
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
EJE-08-0039v1
158/6/905    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castan-Laurell, I.
Right arrow Articles by Valet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castan-Laurell, I.
Right arrow Articles by Valet, P.
CLINICAL STUDIES

Effect of hypocaloric diet-induced weight loss in obese women on plasma apelin and adipose tissue expression of apelin and APJ.

Isabelle Castan-Laurell1,2,*, Michaela Vítkova3,*, Danièle Daviaud1,2, Cédric Dray1,2, Michaela Kováciková3,4,5, Zuzana Kovacova3,4,5, Jindriska Hejnova3,4, Vladimir Stich3,4 and Philippe Valet1,2

1 Inserm, U858 Équipe 3, Institut de Médecine Moléculaire de Rangueil, BP84225, Toulouse F-31432 Cedex 4, France2 Université de Toulouse,, Institut Louis Bugnard IFR31, Toulouse F-31432, France3 Franco-Czech Laboratory for Clinical Research on Obesity,, 4 Department of Sports Medicíne and 5 Division of Cell and Molecular Biology,, 3rd Faculty of Medicine, Charles University in Prague, Prague CZ-100 00, Czech Republic

(Correspondence should be addressed to I Castan-Laurell; Email: isabelle.castan{at}toulouse.inserm.fr)


   Abstract
Top
 Abstract
Introduction
 Subjects and methods
 Results
 Discussion
 Footnotes
 References
 
Objective: Apelin is a novel adipokine acting on APJ receptor, regulated by insulin and tumor necrosis factor-{alpha} (TNF-{alpha}) in adipose tissue (AT). Plasma apelin levels are increased in obese hyperinsulinemic subjects. The aim was to investigate whether the hypocaloric diet associated with weight loss modifies the elevated plasma apelin levels and the expression of apelin and APJ receptor in AT in obese women.

Design and methods: Fasting plasma levels of apelin and TNF-{alpha} as well as mRNA levels of apelin and APJ in AT were measured before and after a 12-week hypocaloric weight-reducing diet in 20 obese women (body mass index (BMI) before diet 32.2±6.4 kg/m2). Twelve healthy women with a BMI of 20.7±0.6 kg/m2 served as reference.

Results: Plasma levels of apelin and TNF-{alpha} were higher in obese compared with lean controls. The hypocaloric diet resulted in a significant decrease of BMI to 29.8±6.3 kg/m2, plasma insulin (8.16±0.73 to 6.58±0.66 mU/l), apelin (369±25 pg/ml to 257±12 pg/ml), TNF-{alpha} levels (0.66±0.04 pg/ml to 0.56±0.04 pg/ml), and AT mRNAs of apelin and APJ. In addition, changes in AT mRNA apelin were related to changes in AT mRNA APJ levels.

Conclusion: The hypocaloric diet associated with weight loss reduces the increased plasma and AT expression of apelin in obese women. This reduced apelin expression in AT could contribute to decreased circulating apelin levels.


   Introduction
Top
 Abstract
 Introduction
Subjects and methods
 Results
 Discussion
 Footnotes
 References
 
Apelin has been described as a new adipokine, produced and secreted by human and mouse mature adipocytes (1). Apelin is a bioactive peptide identified as the endogenous ligand of APJ, a G protein-coupled receptor (2, 3). Apelin peptides are derived from a 77 amino acid precursor, which is processed to several active molecular forms such as apelin-36 or apelin-13 in different tissues and in the bloodstream (4). Apelin and APJ have been found to be expressed in the hypothalamus, stomach, endothelial cells, vascular smooth muscle cells, and cardiomyocytes (for review see (5)) in mouse adipocytes (6) and human osteoblasts (7). The most documented functions of apelin/APJ concern the regulation of fluid homeostasis (8) and the modifications of cardiac contractility and blood pressure (5).

So far, few data regarding the regulation of apelin or APJ are available, especially in humans. Apelin and APJ expression have been shown to follow the same pattern of regulation in human heart failure (9). Regulation of apelin expression by insulin (1) and tumor necrosis factor (TNF-{alpha}) (10) in human adipocytes or adipose tissue (AT) has also been reported. Moreover, the basal plasma levels of apelin are significantly higher in obese patients compared with control lean individuals (1), correlating positively with body mass index (BMI) (11). These data suggest that apelin could play an important role in obesity-related metabolic and cardiovascular alterations.

Therefore, the aim of this study was to investigate whether the increased plasma apelin levels previously reported in obese subjects are reduced after a hypocaloric diet in obese women and to study the effect of the hypocaloric diet on the expression of apelin and APJ in human s.c. abdominal AT.


   Subjects and methods
Top
 Abstract
 Introduction
 Subjects and methods
Results
 Discussion
 Footnotes
 References
 
Subjects

Twenty obese women (age 39.4±9.5 years, range of body weight 72.5–132.5 kg) with a BMI of 32.2±1.4 kg/m2 participated in the study. All women were premenopausal, drug free, and, based on their medical history, clinical findings and entry laboratory examination, did not suffer of any disease besides obesity. Their body weight was stable for at least 3 months before the beginning of the study. To obtain references values, 12 healthy and lean women (age 37.7±2.8 years, weight 57.1±1.3 kg, BMI 20.7±0.6 kg/m2, fat mass 22.5±1.9%) were chosen. Informed consent to participate in the study was obtained from each subject before the beginning of the experiments. The study was performed according to the Declaration of Helsinki and approved by the Ethical Committee of Third Faculty of Medicine (Prague, Czech Republic).

Examination procedures

The subjects were investigated at 0800 h after an overnight fast before and at the end of 12 weeks of low-calorie diet (LCD). The clinical parameters of the subjects are shown in Table 1. Body composition was assessed using multifrequency bioimpedance (Bodystat, Quad scan 4000, Isle of Man, UK). Coefficients of variation of fat mass, fat-free mass, and impedance were 1.7, 0.8, and 1.5% respectively. Samples of 10 ml blood were collected on 50 µl of an anticoagulant and antioxidant cocktail (Immunotech, Marseille, France) and processed immediately in a refrigerated centrifuge. The plasma was stored at –80 °C until analysis. Needle biopsy of s.c. AT (0.5–1.0 g) was performed under local anesthesia (1% Xylocain) in the abdominal region (10–15 cm lateral of umbilic) and immediately frozen.


View this table:
[in this window]
[in a new window]

  		Table 1 Clinical characteristics and metabolic parameters of lean controls and obese subjects before and after low-calorie diet (LCD).

 
Dietary intervention

The diet was designed to provide 600 kcal/day less than the individually estimated energy requirement, based on calculated pretreatment resting metabolic rate multiplied by a coefficient of correction for physical activity level of 1.3. The target macronutrient composition of the diet was 25–30% of total energy from fat, 15% from protein, and 55–60% from carbohydrate. The subjects were given oral and written instructions relating to these targets based on either a template or an exchange system. The subjects were requested to abstain from alcohol consumption. The dietary instructions were reinforced and monitored by dieticians weekly. Compliance to the diet was monitored using 1-day weighed food records that were presented each week during the above-mentioned dietary consultation session. In addition to that, a 3-day weighed food record of two weekdays and one weekend day was performed before the study and during the last week of the intervention. The dietary records were analyzed using the food nutrient database routinely used in each center.

Real-time RT-PCR

Total RNAs (0.5 µg) were isolated from AT biopsies using RNeasy Lipid Tissue Kits (Qiagen) and were reverse transcribed using random hexamers and Superscript II reverse transcriptase (Invitrogen). Real time PCR was generated by SYBER green method and performed as previously described (1). Analysis of the 18S rRNA was performed in parallel using the rRNA control Taqman Assay Kit (Applied Biosystem, Foster City, CA, USA) to normalize gene expression. The following oligonucleotide primer pairs were used: apelin Sens: GCGGTTATGTCTCCTCCATAGATT, Reverse: GTGCGAGGTGAGAGCTGAATG; APJ Sens: GCCCTTGCTTTCTGAAAATCA, Reverse: GGACAGTTAAAGGATGTGCATAGGA.

Analytical methods

Plasma glucose was determined by the glucose-oxidase technique (Beckman Instruments, Brea, CA, USA). Plasma insulin concentration was measured by RIA (Immunotech, Czech Republic). Plasma apelin levels were measured with a commercially available enzyme-linked immunoassay (ELISA) kit (Phoenix Pharmaceuticals, Burlingame, CA, USA). The sensitivity of the assay was 0.2 ng/ml and the intra-assay error was below 5%. The ELISA had 100% cross-reactivity with human apelin-12, apelin-13, and apelin-36. Concentrations of TNF-{alpha} in plasma were measured using ultra-sensitive ELISA kit (Biosource International, Camarillo, CA, USA).

Statistical analysis

Statistical analysis was performed using SPSS 12.0 for Windows (SPSS Inc., Chicago, Illinois, USA). Differences were tested with non-parametric Wilcoxon's test for paired observations. Correlations were analyzed by Spearman's non-parametric test. Data are presented as means±S.E.M. Differences at the level of P<0.05 were considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Subjects and methods
 Results
Discussion
 Footnotes
 References
 
Effect of LCD on metabolic variables

The LCD resulted in mean body weight loss of 6.7±0.6 kg (7.4% loss of the initial body weight), a reduction of total and high density lipoprotein (HDL) cholesterol, plasma triglycerides, and no change in blood glucose and blood pressure. Moreover, homeostasis model assessment index of insulin resistance (HOMA-IR) was decreased suggesting an increase in insulin sensitivity of the subjects (Table 1).

Effect of LCD on plasma apelin, insulin, and TNF-{alpha} levels

Apelin plasma levels were elevated in obese (369±25 pg/ml, n=20) compared with lean women (272±20 pg/ml, n=12, P=0.02). After LCD, plasma levels of apelin in obese subjects were significantly decreased (Fig. 1). Plasma concentrations of TNF-{alpha} (0.66±0.04 pg/ml, n=20 vs 0.54±0.07 pg/ml, n=12, P=0.014) and insulin (8.16±0.73 mU/ml, n=20 vs 4.31±0.56 mU/ml, n=12) were also higher in obese compared with controls and, like apelin, decreased after LCD (Fig. 1).


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		Figure 1 Plasma apelin, insulin, and TNF-{alpha} levels in lean (n=12) and obese women before and after LCD (n=20). Data are presented as mean±S.E.M. *P<0.05 compared with lean subjects, °°P<0.001 compared with obese before LCD. °P<0.05 compared with obese before LCD.

 
Associations of plasma apelin levels with anthropometric and metabolic variables

No correlation between the diet-induced decrease of insulin or TNF-{alpha} blood levels and plasma apelin was found in the entire group. Then the patients were stratified into two subgroups according to the magnitude of the diet-induced decrease of insulin resistance: group 1 (designated as high responders, n=12) with a decrease of HOMA-IR by more than 20% of the initial value and group 2 (low responders, n=8) with a decrease of HOMA-IR ≤20%. In the subgroup of high responders, the diet-induced changes in plasma apelin levels directly correlated with the diet-induced decrease of metabolic variables such as plasma insulin and TNF-{alpha} levels (Table 2) but also the decrease of HOMA-IR, waist circumference, and waist-to-hip ratio.


View this table:
[in this window]
[in a new window]

  		Table 2 Correlations between the diet-induced changes of plasma apelin levels and those of selected anthropometric and metabolic variables in high and low responders to the diet.

 
Effect of LCD on apelin and APJ expression in AT

In order to know whether the observed decrease of apelin plasma levels could be due to reduced production of apelin by AT, apelin mRNA level was measured in lean and obese subjects before and after LCD. Apelin mRNAs were increased in obese compared with lean subjects (Fig. 2A) and a significant diet-induced decrease of apelin mRNA was observed after LCD. Thus, apelin plasma levels and apelin expression in AT were decreased in obese subjects after LCD (Fig. 3). Since apelin and APJ expression have been shown to often follow the same regulation pattern (9), we studied the expression of APJ in AT in lean and obese subjects before and after LCD. Interestingly, the expression of apelin receptor APJ was also significantly increased in obese compared with lean subjects and decreased in AT after LCD (Fig. 2B). Moreover, a tight positive correlation was observed between changes in apelin and changes in APJ mRNA levels (Fig. 4).


Figure 2
View larger version (23K):
[in this window]
[in a new window]

  		Figure 2 Expression of (A) apelin and (B) APJ in adipose tissue of lean (n=12) and obese women before and after LCD (n=18). Values are means+S.E.M., *P<0.001 compared with lean, °P<0.001 compared with obese before LCD.

 

Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		Figure 3 (A) Individual apelin plasma concentrations (n=20) and (B) adipose tissue apelin mRNA levels before and after LCD in obese subjects (n=18). The mean circulating apelin plasma levels are represented in Fig. 1 and the mean of apelin mRNA expression in AT in Fig. 2.

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		Figure 4 Correlation between changes in apelin (apelin before –apelin after: d) and changes in APJ expression in adipose tissue in obese subjects (n=18). r: Spearman correlation coefficient.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
Footnotes
 References
 
Elevated plasma apelin has been described by our group in moderately (1) and by Heinonen et al. in severe obese (11) individuals. It has also been shown that plasma apelin levels were increased in diabetic subjects and positively correlated with BMI, HOMA-IR, and fasting plasma insulin (12), suggesting a role of apelin in the pathogenesis of type II diabetes. However, no data are available on a potential reversal of the elevated plasma apelin in obese subjects. In the present study, the hypocaloric diet associated with weight reduction resulted in a reduction of plasma apelin levels. At the end of the diet, the plasma apelin levels in obese individuals approached the range found in lean controls. The diet-induced reduction of plasma apelin was associated with a decrease of apelin mRNA expression in s.c. AT. It is to be noted that the diet-induced changes described in this study may be due to body weight loss (i.e. reduction to body fat mass) as well as to the effect of the caloric restriction, i.e., negative energy balance, itself.

It is interesting to note that the relationship between apelin and insulin or TNF-{alpha} during obesity and obesity-associated disorders (1, 10, 12) is still maintained at the end of the hypocaloric diet but is dependent of the magnitude of insulin sensitivity. Therefore, insulin and TNF-{alpha} could be potential candidates involved in the regulation of the diet-induced decrease of apelin blood levels, in agreement with previous studies (1, 6, 10). Leptin could be another candidate regulating apelin production. Indeed, a high correlation has been described between apelin gene expression in s.c. AT and leptin serum or leptin mRNA in rat AT (13). In addition, since a correlation between apelin and HOMA-IR was observed only in subjects ameliorating their insulin sensitivity, the relationship between apelin and insulin resistance is strengthened. The relationship of apelin to blood pressure changes was not assessed since in spite of diet-induced apelin decrease, no correlation between the individual diet-induced change of plasma apelin and systolic and diastolic blood pressure were found. Thus, both plasma apelin and apelin AT mRNA were decreased after LCD suggesting that the reduced apelin expression in AT could contribute to decreased circulating apelin levels. In the present study, AT was obtained from the abdominal s.c. region. The comparative value of apelin expression between intra-abdominal and s.c. AT, and hence their relative contribution to plasma apelin levels are not known. Cross-sectional studies investigating the expression of apelin in visceral fat in relation to s.c. fat expression and to metabolic indices are certainly warranted. However, during dietary intervention, changes in sites other than AT of apelin production are not excluded.

In addition to the effect of the hypocaloric diet on apelin, we also studied APJ expression in AT. Apelin and APJ receptor are often co-localized in the same tissues and display similar variations of expression. The most documented co-regulation of the apelin/APJ system was reported in the cardiovascular domain. Either down-regulated (9) or increased expression (14) of both apelin and APJ were observed in humans or rodents heart presenting cardiac dysfunction. In the present study, we found not only a decrease of APJ and apelin expression after LCD period but also a significant correlation between the diet-induced changes of apelin and APJ expression in AT. Therefore, a similar regulation of apelin and APJ mRNA expression in human AT may be suggested and a common factor regulating apelin and APJ expression could be hypothesized.

In conclusion, the present study demonstrates that, in obese women, the hypocaloric diet associated with weight reduction and with a decrease of insulin resistance promotes a reduction of the elevated plasma apelin levels and the expression of apelin and APJ in s.c. AT. Although apelin has been viewed as a beneficial adipokine up-regulated in obesity (15, 16), it remains to establish whether the increased levels of apelin observed in obesity are an attempt to overcome either insulin resistance or obesity-related cardiovascular diseases or another metabolic defect such as apelin resistance. Thus, understanding the contribution of such an adipokine in obesity-associated disorders appears to be of major importance.


   Acknowledgements
 
This study was supported by grant 303/04/0158 of grant agency of Czech Republic, grant IGA NR 9161-3-2007 of the Ministry of Health of Czech Republic, by the research project of MSMT of Czech Republic MSM 0021620814, and by the project MolPAGE, supported by the European Commission under the 6th Framework Programme (Project 512066 (LSHG-CT-2004)). We thank for technical assistance Zuzana Parizkova and Marie-Adeline Marquez.


   Footnotes
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Footnotes
References
 
* I Castan-Laurell and M Vítkova contributed equally to this work Back


   References
Top
 Abstract
 Introduction
 Subjects and methods
 Results
 Discussion
 Footnotes
 References
 

    1. Boucher J, Masri B, Daviaud D, Gesta S, Guigne C, Mazzucotelli A, Castan-Laurell I, Tack I, Knibiehler B, Carpene C, Audigier Y, Saulnier-Blache JS & Valet P. Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology 2005; 146: 1764–1771.[Abstract/Free Full Text]

    2. Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H & Fujino M. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochemical and Biophysical Research Communications 1998; 251: 471–476.[CrossRef][Web of Science][Medline]

    3. Falcao-Pires I & Leite-Moreira AF. Apelin: a novel neurohumoral modulator of the cardiovascular system: pathophysiologic importance and potential use as a therapeutic target. Revista Portuguesa de Cardiologia 2005; 24: 1263–1276.[Medline]

    4. Masri B, Knibiehler B & Audigier Y. Apelin signalling: a promising pathway from cloning to pharmacology. Cellular Signalling 2005; 17: 415–426.[CrossRef][Web of Science][Medline]

    5. Kleinz MJ & Davenport AP. Emerging roles of apelin in biology and medicine. Pharmacology and Therapeutics 2005; 107: 198–211.

    6. Wei L, Hou X & Tatemoto K. Regulation of apelin mRNA expression by insulin and glucocorticoids in mouse 3T3-L1 adipocytes. Regulatory Peptides 2005; 132: 27–32.[CrossRef][Web of Science][Medline]

    7. Xie H, Tang SY, Cui RR, Huang J, Ren XH, Yuan LQ, Lu Y, Yang M, Zhou HD, Wu XP, Luo XH & Liao EY. Apelin and its receptor are expressed in human osteoblasts. Regulatory Peptides 2006; 134: 118–125.[CrossRef][Web of Science][Medline]

    8. De Mota N, Reaux-Le Goazigo A, El Messari S, Chartrel N, Roesch D, Dujardin C, Kordon C, Vaudry H, Moos F & Llorens-Cortes C. Apelin, a potent diuretic neuropeptide counteracting vasopressin actions through inhibition of vasopressin neuron activity and vasopressin release. PNAS USA 2004; 101: 10464–10469.[Abstract/Free Full Text]

    9. Iwanaga Y, Kihara Y, Takenaka H & Kita T. Down-regulation of cardiac apelin system in hypertrophied and failing hearts: possible role of angiotensin II-angiotensin type 1 receptor system. Journal of Molecular and Cellular Cardiology 2006; 41: 798–806.[CrossRef][Web of Science][Medline]

    10. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, Quilliot D, Ayav A, Ziegler O, Carpene C, Saulnier-Blache JS, Valet P & Castan-Laurell I. TNF-{alpha} up-regulates apelin expression in human and mouse adipose tissue. FASEB Journal 2006; 20: 1528–1530.[Abstract/Free Full Text]

    11. Heinonen MV, Purhonen AK, Miettinen P, Paakkonen M, Pirinen E, Alhava E, Akerman K & Herzig KH. Apelin, orexin-A and leptin plasma levels in morbid obesity and effect of gastric banding. Regulatory Peptides 2005; 130: 7–13.[CrossRef][Web of Science][Medline]

    12. Li L, Yang G, Li Q, Tang Y, Yang M, Yang H & Li K. Changes and relations of circulating visfatin, apelin, and resistin levels in normal, impaired glucose tolerance, and type 2 diabetic subjects. Experimental and Clinical Endocrinology and Diabetes 2006; 114: 544–548.

    13. Garcia-Diaz D, Campion J, Milagro FI & Martinez JA. Adiposity dependent apelin gene expression: relationships with oxidative and inflammation markers. Molecular and Cellular Biochemistry 2007; 305: 87–94.[Web of Science][Medline]

    14. Atluri P, Morine KJ, Liao GP, Panlilio CM, Berry MF, Hsu VM, Hiesinger W, Cohen JE & Joseph Woo Y. Ischemic heart failure enhances endogenous myocardial apelin and APJ receptor expression. Cellular and Molecular Biology Letters 2007; 12: 127–138.[CrossRef][Web of Science][Medline]

    15. Beltowski J. Apelin and visfatin: unique ‘beneficial’ adipokines upregulated in obesity? Medical Science Monitor 2006; 12: RA112–RA119.

    16. Castan-Laurell I, Boucher J, Dray C, Daviaud D, Guigne C & Valet P. Apelin, a novel adipokine over-produced in obesity: friend or foe? Molecular and Cellular Endocrinology 2005; 245: 7–9.[Web of Science][Medline]

Received 28 February 2008
Accepted 20 March 2008




This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
P. Yue, H. Jin, M. Aillaud, A. C. Deng, J. Azuma, T. Asagami, R. K. Kundu, G. M. Reaven, T. Quertermous, and P. S. Tsao
Apelin is necessary for the maintenance of insulin sensitivity
Am J Physiol Endocrinol Metab, January 1, 2010; 298(1): E59 - E67.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
D.-E. Lee, S. Kehlenbrink, H. Lee, M. Hawkins, and J. S. Yudkin
Getting the message across: mechanisms of physiological cross talk by adipose tissue
Am J Physiol Endocrinol Metab, June 1, 2009; 296(6): E1210 - E1229.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
EJE-08-0039v1
158/6/905    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castan-Laurell, I.
Right arrow Articles by Valet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castan-Laurell, I.
Right arrow Articles by Valet, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS